circad | circRNAs associated with diseases

circMAN2B2/hsa_circRNA_103595
Gene	MAN2B2	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29550475
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	lung tissues and human lung cell line BESA-2B and four lung cancer cell lines(A549, H226, H1299 and H446)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGGACATTTTGCCTCGGTCT3 Reverse GGTGCGTTGCGTACATGTCTC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Ma, X, Yang, X, Bao, W, Li, S, Liang, S, Sun, Y, Zhao, Y, Wang, J, Zhao, C (2018). Circular RNA circMAN2B2 facilitates lung cancer cell proliferation and invasion via miR-1275/FOXK1 axis. Biochem. Biophys. Res. Commun., 498, 4:1009-1015.